Journal: Applied and Environmental Microbiology

Article Title: Involvement of Two-Component System CBO0366/CBO0365 in the Cold Shock Response and Growth of Group I (Proteolytic) Clostridium botulinum ATCC 3502 at Low Temperatures

doi: 10.1128/AEM.00555-12

Figure Lengend Snippet: Oligonucleotide primers

Article Snippet: Bacterial strains and plasmids table ft1 table-wrap mode="anchored" t5 caption a7 Primer Sequence (5′→3′) a Use c Binding site in ATCC 3502 genome b cbo0365 -f AATGATGCCTAAGATGGATGGT qRT-PCR 424216–424237 cbo0365 -r TCTGCACCTGTGGTTAATCCT qRT-PCR 424324–424344c cbo0366 -f GGCATACCAAGAGCAGAAACCA qRT-PCR 425289–425310 cbo0366 -r ATTTGCAGCAAGCCCTTTGA qRT-PCR 425421–425440c 16S rrn -f TTGTCGTCAGCTCGTGTCGT qRT-PCR 10290–10309 16S rrn -r CCTGGACATAAGGGGCATGA qRT-PCR 10431–10450c cbo0366 -f-NdeI NNNNNN CATATG AAACCTTTCAAATATATA Construction of overexpression plasmid for cbo0366 424779–424796 cbo0366- r-NheI NNNNNN GCTAGC TTATTCATCCTCTGCCATAA Construction of overexpression plasmid for cbo0366 426235–426254c EBS Universal CGAAATTAGAAACTTGCGTTCAGTAAAC Retargeting of pMTL007, control for correct mutation site in cbo0365 and cbo0366 NA cbo0365 -IBS AAAAAAGCTTATAATTATCCTTAAAAGACATCAGAGTGCGCCCAGATAGGGTG Construction of pMTL007- cbo0365- 48s NA cbo0365 -EBS1d CAGATTGTACAAATGTGGTGATAACAGATAAGTCATCAGAGATAACTTACCTTTCTTTGT Construction of pMTL007- cbo0365- 48s NA cbo0365 -EBS2 TGAACGCAAGTTTCTAATTTCGGTTTCTTTCCGATAGAGGAAAGTGTCT Construction of pMTL007- cbo0365- 48s NA cbo0365 M-f TTGTTGATGATGAAAAAGAAATCA Control of pMTL007- cbo0365- 48s 424074–424097 cbo0366 -IBS AAAAAAGCTTATAATTATCCTTAACTATCCAAGAAGTGCGCCCAGATAGGGTG Construction of pMTL007- cbo0366- 267s NA cbo0366 -EBS1d CAGATTGTACAAATGTGGTGATAACAGATAAGTCCAAGAACTTAACTTACCTTTCTTTGT Construction of pMTL007- cbo0366- 267s NA cbo0366 -EBS2 TGAACGCAAGTTTCTAATTTCGATTATAGTTCGATAGAGGAAAGTGTCT Construction of pMTL007- cbo0366- 267s NA cbo0366 M-f TTTTTAATGGCTATTATGACCTTTATT Control of pMTL007- cbo0366- 267s 424866–424892 Open in a separate window a Underlined portions of sequences indicate the restriction endonuclease site. b Based on EMBL accession number {"type":"entrez-nucleotide","attrs":{"text":"AM412317","term_id":"148287495","term_text":"AM412317"}} AM412317 (positions are shown according to base pair number). c, complement strand; NA, not applicable. c 48s and 267s represent mutations between bases 48 and 49 and between bases 267 and 268, respectively, in the sense orientation.

Techniques: Sequencing, Binding Assay, Over Expression, Plasmid Preparation, Mutagenesis

Journal: American journal of physiology. Gastrointestinal and liver physiology

Article Title: Selective phosphorylation of the IP3R-I in vivo by cGMP-dependent protein kinase in smooth muscle.

doi: 10.1152/ajpgi.00401.2002

Figure Lengend Snippet: Fig. 3. In vitro phosphorylation of IP3R-I by PKA and PKG. A: IP3R-I was immunoprecipitated and phosphorylated in the presence of [-32P]ATP by PKG-I holoenzyme alone for 30 min (filled bar) or sequentially by PKG-I for 30 min and by the catalytic subunit of PKA for 30 min (hatched bar). B: immunoprecipitated IP3R-I was phosphorylated by the catalytic subunit of PKA alone for 30 min (filled bar) or sequentially by the catalytic subunit of PKA for 30 min and by PKG-I for 30 min (hatched bar). Basal phosphorylation represents 32P incorporation in the absence of PKA and PKG. [32P] p-IP3R-I was identified by autoradiography, and the radioactivity in the bands was expressed as counts/min (cpm). Immunoblots of the IP3R-I bands are shown for loading control. Values are means SE of 4 experiments. **P 0.01 significant increase in phosphorylation over that induced by PKG-I alone.

Article Snippet: [ -32P]ATP and [32P]orthophosphate were obtained from Amersham Pharmacia Biotech (Piscataway, NJ); collagenase and soybean trypsin inhibitor were from Worthington Biochemical (Freehold, NJ); 8-(4-chlorophenylthio) guanosine 3 ,5 -cyclic monophosphate (8-pCPT-cGMP) and 5,6-dichloro-1- -D-ribofuranosyl benzimidazole 3 ,5-cyclic monophosphothioate, Sp-isomer (cBIMPS) were from Alexis Biochemicals (San Diego, CA); IP3 was from Calbiochem (San Diego, CA); Western blotting and chromatography material and protein assay kit were from Bio-Rad Laboratories (Hercules, CA); antibody to IP3R types I, II, and III were from Santa Cruz (Santa Cruz, CA).

Techniques: In Vitro, Phospho-proteomics, Immunoprecipitation, Autoradiography, Radioactivity, Western Blot, Control

Journal: American journal of physiology. Gastrointestinal and liver physiology

Article Title: Selective phosphorylation of the IP3R-I in vivo by cGMP-dependent protein kinase in smooth muscle.

doi: 10.1152/ajpgi.00401.2002

Figure Lengend Snippet: Fig. 2. Expression of inositol 1,4,5- trisphosphate (IP3) receptor (IP3R) types in cultured gastric smooth muscle cells. A: RNA isolated from primary cultures of rabbit gastric smooth muscle cells was reverse transcribed and cDNA amplified using specific primers for IP3R-I, -II, and -III. Experiments were done in the presence () or absence of () of RT. Transcript sizes were 194 bp for IP3R-I and 400 bp for IP3R-III. No RT-PCR product was obtained with primers for IP3R-II. Identical results were obtained in gastric smooth muscle cells after first passage (data not shown). B: Western blot analysis of lysates prepared from dispersed rabbit gastric smooth muscle cells and probed with polyclonal antibodies to IP3R-I, -II, and -III. West- ern blot confirmed expression of IP3R-I and IP3R-III but not IP3R-II. Selective phosphorylation of IP3R-I but not IP3R-III occurred in cells treated with 1 M sodium nitroprusside.

Article Snippet: [ -32P]ATP and [32P]orthophosphate were obtained from Amersham Pharmacia Biotech (Piscataway, NJ); collagenase and soybean trypsin inhibitor were from Worthington Biochemical (Freehold, NJ); 8-(4-chlorophenylthio) guanosine 3 ,5 -cyclic monophosphate (8-pCPT-cGMP) and 5,6-dichloro-1- -D-ribofuranosyl benzimidazole 3 ,5-cyclic monophosphothioate, Sp-isomer (cBIMPS) were from Alexis Biochemicals (San Diego, CA); IP3 was from Calbiochem (San Diego, CA); Western blotting and chromatography material and protein assay kit were from Bio-Rad Laboratories (Hercules, CA); antibody to IP3R types I, II, and III were from Santa Cruz (Santa Cruz, CA).

Techniques: Expressing, Cell Culture, Isolation, Reverse Transcription, Reverse Transcription Polymerase Chain Reaction, Western Blot, Phospho-proteomics

Journal: American journal of physiology. Gastrointestinal and liver physiology

Article Title: Selective phosphorylation of the IP3R-I in vivo by cGMP-dependent protein kinase in smooth muscle.

doi: 10.1152/ajpgi.00401.2002

Figure Lengend Snippet: Fig. 5. PKG-dependent phosphorylation of IP3R-I by SNP and 8-pCPT-cGMP. (a) Gastric smooth muscle cells were labeled with 32P and then treated with SNP (1 M) or 8-(4-chlorophenylthio) guanosine 3,5-cyclic monophosphate (8-pCPT-cGMP; 10 M) in the presence or absence of myristoylated PKI (1 M) or (8R,9S,11s)-()- 9-methoxy-carbamyl-8-methyl-2,3,9,10-tetrahydro-8,11-epoxy- 1H,8H,1H,-2,7b,11a-trizadizo-benzo9(a,g)cycloocta(c,d,e)-trinden-1- one (KT5823; 1 M). [32P]IP3R-I was immunoprecipitated, and radioactivity in the bands was expressed as cpm. Immunoblots of the IP3R-I bands are shown for loading control. B: back phosphorylation technique: smooth muscle cells were first treated with sodium nitro- prusside (SNP) or 8-pCPT-cGMP in the presence or absence of myristoylated PKI or KT5823; after immunoprecipitation, IP3I-R was phosphorylated in vitro in the presence of PKG-I holoenzyme and [-32P]ATP. Control cells were treated in similar fashion without SNP or 8-pCPT-cGMP. The difference between 32P incorporation in control cells (100%) and cells treated with SNP or 8-pCPT-cGMP represents the extent of endogenous (in vivo) phosphorylation by the 2 agents. Radioactive bands are not shown for back phosphorylation. Values are means SE of 4 experiments each in A and B. With both techniques, a significant increase in phosphorylation (P 0.01) was selectively suppressed by the PKG inhibitor KT5823.

Article Snippet: [ -32P]ATP and [32P]orthophosphate were obtained from Amersham Pharmacia Biotech (Piscataway, NJ); collagenase and soybean trypsin inhibitor were from Worthington Biochemical (Freehold, NJ); 8-(4-chlorophenylthio) guanosine 3 ,5 -cyclic monophosphate (8-pCPT-cGMP) and 5,6-dichloro-1- -D-ribofuranosyl benzimidazole 3 ,5-cyclic monophosphothioate, Sp-isomer (cBIMPS) were from Alexis Biochemicals (San Diego, CA); IP3 was from Calbiochem (San Diego, CA); Western blotting and chromatography material and protein assay kit were from Bio-Rad Laboratories (Hercules, CA); antibody to IP3R types I, II, and III were from Santa Cruz (Santa Cruz, CA).

Techniques: Phospho-proteomics, Labeling, Immunoprecipitation, Radioactivity, Western Blot, Control, In Vitro, In Vivo

Journal: American journal of physiology. Gastrointestinal and liver physiology

Article Title: Selective phosphorylation of the IP3R-I in vivo by cGMP-dependent protein kinase in smooth muscle.

doi: 10.1152/ajpgi.00401.2002

Figure Lengend Snippet: Fig. 4. Combined phosphorylation of IP3R-I by PKA and PKG. IP3R-I immunoprecipitates were phosphorylated with nonradioac- tive ATP in the presence of the catalytic subunit of PKA for 30 min followed by phosphorylation with [-32P]ATP in the absence (lane 1) or presence of PKG-I holoenzyme for another 30 min (lane 2). IP3R-I was phosphorylated with nonradioactive ATP in the presence of PKG-I holoenzyme for 30 min followed by phosphorylation with [-32P]ATP in the absence (lane 3) or presence of the catalytic subunit of PKA for 30 min (lane 4). [32P]IP3R-I was identified by autoradiography and radioactivity in the bands was expressed as cpm. Immunoblots of the IP3R-I bands are shown for loading control. Values are means SE of 4 experiments. **P 0.01 significant increase in 32P incorporation by PKA.

Article Snippet: [ -32P]ATP and [32P]orthophosphate were obtained from Amersham Pharmacia Biotech (Piscataway, NJ); collagenase and soybean trypsin inhibitor were from Worthington Biochemical (Freehold, NJ); 8-(4-chlorophenylthio) guanosine 3 ,5 -cyclic monophosphate (8-pCPT-cGMP) and 5,6-dichloro-1- -D-ribofuranosyl benzimidazole 3 ,5-cyclic monophosphothioate, Sp-isomer (cBIMPS) were from Alexis Biochemicals (San Diego, CA); IP3 was from Calbiochem (San Diego, CA); Western blotting and chromatography material and protein assay kit were from Bio-Rad Laboratories (Hercules, CA); antibody to IP3R types I, II, and III were from Santa Cruz (Santa Cruz, CA).

Techniques: Phospho-proteomics, Autoradiography, Radioactivity, Western Blot, Control

Journal: American journal of physiology. Gastrointestinal and liver physiology

Article Title: Selective phosphorylation of the IP3R-I in vivo by cGMP-dependent protein kinase in smooth muscle.

doi: 10.1152/ajpgi.00401.2002

Figure Lengend Snippet: Fig. 7. PKG-dependent phosphorylation of IP3R-I by forskolin. A: gastric smooth muscle cells were labeled with 32P and then treated with forskolin (10 M) or the PKA activator 5,6-dichloro-1--D- ribofuranosyl benzimidazole 3,5-cyclic monophosphothioate, Sp-iso- mer (cBIMPS; 10 M) in the presence or absence of myristoylated PKI (1 M) or KT5823 (1 M). [32P]IP3R-I was immunoprecipitated, and radioactivity in the bands was expressed as cpm. Immunoblots of the IP3R-I bands are shown for loading control. B: back phosphor- ylation: the cells were first treated with forskolin or cBIMPS in the presence or absence of myristoylated PKI or KT5823. After immu- noprecipitation, IP3I-R was phosphorylated in vitro in the presence of PKG-I holoenzyme and [-32P]ATP. Control cells were treated in similar fashion without forskolin or cBIMPS. Radioactive bands are not shown for back phosphorylation. Values are means SE of 4 experiments each in A and B. No IP3R-I phosphorylation was ob- served with cBIMPS. With both techniques, significant increase in phosphorylation (P 0.01) by forskolin was selectively suppressed by KT5823.

Article Snippet: [ -32P]ATP and [32P]orthophosphate were obtained from Amersham Pharmacia Biotech (Piscataway, NJ); collagenase and soybean trypsin inhibitor were from Worthington Biochemical (Freehold, NJ); 8-(4-chlorophenylthio) guanosine 3 ,5 -cyclic monophosphate (8-pCPT-cGMP) and 5,6-dichloro-1- -D-ribofuranosyl benzimidazole 3 ,5-cyclic monophosphothioate, Sp-isomer (cBIMPS) were from Alexis Biochemicals (San Diego, CA); IP3 was from Calbiochem (San Diego, CA); Western blotting and chromatography material and protein assay kit were from Bio-Rad Laboratories (Hercules, CA); antibody to IP3R types I, II, and III were from Santa Cruz (Santa Cruz, CA).

Techniques: Phospho-proteomics, Labeling, Immunoprecipitation, Radioactivity, Western Blot, Control, In Vitro

Journal: American journal of physiology. Gastrointestinal and liver physiology

Article Title: Selective phosphorylation of the IP3R-I in vivo by cGMP-dependent protein kinase in smooth muscle.

doi: 10.1152/ajpgi.00401.2002

Figure Lengend Snippet: Fig. 6. Concentration-dependent phosphorylation of IP3R-I by SNP. Phosphorylation of IP3R-I was determined by the technique of back phosphorylation as described in MATERIALS AND METHODS and the legend to Fig. 5. As shown in the radioactive bands, maximal IP3R-I back phosphorylation was observed in the basal state (B). Increasing in vivo phosphorylation with SNP concentration was reflected by a decrease of radioactivity in the bands. Immunoblots of the IP3R-I bands are shown for loading control. Values are means SE of 5 experiments.

Article Snippet: [ -32P]ATP and [32P]orthophosphate were obtained from Amersham Pharmacia Biotech (Piscataway, NJ); collagenase and soybean trypsin inhibitor were from Worthington Biochemical (Freehold, NJ); 8-(4-chlorophenylthio) guanosine 3 ,5 -cyclic monophosphate (8-pCPT-cGMP) and 5,6-dichloro-1- -D-ribofuranosyl benzimidazole 3 ,5-cyclic monophosphothioate, Sp-isomer (cBIMPS) were from Alexis Biochemicals (San Diego, CA); IP3 was from Calbiochem (San Diego, CA); Western blotting and chromatography material and protein assay kit were from Bio-Rad Laboratories (Hercules, CA); antibody to IP3R types I, II, and III were from Santa Cruz (Santa Cruz, CA).

Techniques: Concentration Assay, Phospho-proteomics, In Vivo, Radioactivity, Western Blot, Control

Journal: American journal of physiology. Gastrointestinal and liver physiology

Article Title: Selective phosphorylation of the IP3R-I in vivo by cGMP-dependent protein kinase in smooth muscle.

doi: 10.1152/ajpgi.00401.2002

Figure Lengend Snippet: Fig. 9. PKG-dependent phosphorylation of IP3R-I by VIP. (a) Gastric smooth muscle cells were labeled with 32P and then treated with vasoactive intestinal peptide (VIP; 1 M) in the presence or absence of myristoylated PKI (1 M) or KT5823 (1 M). [32P]IP3R-I was immunoprecipitated, and radioactivity in the bands was expressed as cpm. Immunoblots of the IP3R-I bands are shown for loading control. B: back phosphorylation: the cells were first treated with VIP in the presence or absence of myristoylated PKI or KT5823; after immunoprecipitation, IP3I-R was phosphorylated in vitro in the presence of PKG-I holoenzyme and [-32P]ATP. Control cells were treated in similar fashion without VIP. Radioactive bands are not shown for back phosphorylation. Values are means SE of 4 exper- iments each in A and B. With both techniques, a significant increase in phosphorylation (P 0.01) by VIP was selectively suppressed by KT5823.

Article Snippet: [ -32P]ATP and [32P]orthophosphate were obtained from Amersham Pharmacia Biotech (Piscataway, NJ); collagenase and soybean trypsin inhibitor were from Worthington Biochemical (Freehold, NJ); 8-(4-chlorophenylthio) guanosine 3 ,5 -cyclic monophosphate (8-pCPT-cGMP) and 5,6-dichloro-1- -D-ribofuranosyl benzimidazole 3 ,5-cyclic monophosphothioate, Sp-isomer (cBIMPS) were from Alexis Biochemicals (San Diego, CA); IP3 was from Calbiochem (San Diego, CA); Western blotting and chromatography material and protein assay kit were from Bio-Rad Laboratories (Hercules, CA); antibody to IP3R types I, II, and III were from Santa Cruz (Santa Cruz, CA).

Techniques: Phospho-proteomics, Labeling, Immunoprecipitation, Radioactivity, Western Blot, Control, In Vitro

Journal: American journal of physiology. Gastrointestinal and liver physiology

Article Title: Selective phosphorylation of the IP3R-I in vivo by cGMP-dependent protein kinase in smooth muscle.

doi: 10.1152/ajpgi.00401.2002

Figure Lengend Snippet: Fig. 8. PKG-dependent phosphorylation of IP3R-I by high concentra- tions of isoproterenol. A: gastric smooth muscle cells were labeled with 32P and then treated with 1 or 100 M isoproterenol or in the presence or absence of myristoylated PKI (1 M) or KT5823 (1 M). [32P]IP3R-I was immunoprecipitated, and radioactivity in the bands was expressed as cpm. Immunoblots of the IP3R-I bands are shown for loading control. B: back phosphorylation: the cells were first treated with isoproterenol in the presence or absence of myristoy- lated PKI or KT5823, and IP3I-R immunoprecipitates were phos- phorylated in vitro in the presence of PKG-I holoenzyme and [-32P]ATP. Control cells were treated in similar fashion without isoproterenol. Radioactive bands are not shown for back phosphory- lation. Values are means SE of 4 experiments each in A and B. With both techniques, significant increase in phosphorylation (P 0.01) observed with 100 M isoproterenol was selectively suppressed by KT5823.

Article Snippet: [ -32P]ATP and [32P]orthophosphate were obtained from Amersham Pharmacia Biotech (Piscataway, NJ); collagenase and soybean trypsin inhibitor were from Worthington Biochemical (Freehold, NJ); 8-(4-chlorophenylthio) guanosine 3 ,5 -cyclic monophosphate (8-pCPT-cGMP) and 5,6-dichloro-1- -D-ribofuranosyl benzimidazole 3 ,5-cyclic monophosphothioate, Sp-isomer (cBIMPS) were from Alexis Biochemicals (San Diego, CA); IP3 was from Calbiochem (San Diego, CA); Western blotting and chromatography material and protein assay kit were from Bio-Rad Laboratories (Hercules, CA); antibody to IP3R types I, II, and III were from Santa Cruz (Santa Cruz, CA).

Techniques: Phospho-proteomics, Labeling, Immunoprecipitation, Radioactivity, Western Blot, Control, In Vitro

Journal: American journal of physiology. Gastrointestinal and liver physiology

Article Title: Selective phosphorylation of the IP3R-I in vivo by cGMP-dependent protein kinase in smooth muscle.

doi: 10.1152/ajpgi.00401.2002

Figure Lengend Snippet: Fig. 11. Phosphorylation-dependent inhibition of Ca2 release from smooth muscle microsomes. Microsomes prepared from dispersed gastric smooth muscle cells were loaded with 45Ca2 for 60 min when a steady state of Ca2 uptake was attained (16). The microsomes were treated for 15 min with PKG-I holoenzyme (0.5 M) or the catalytic subunit of PKA (0.5 M), followed by the addition of IP3 for 15 s. Ca2 release was determined from the decrease in steady-state microsomal 45Ca2 content. Results were expressed as %maximal release. Inset: phosphorylation of IP3R-I in microsomes by PKG and PKA. Values are means SE of 5 experiments.

Article Snippet: [ -32P]ATP and [32P]orthophosphate were obtained from Amersham Pharmacia Biotech (Piscataway, NJ); collagenase and soybean trypsin inhibitor were from Worthington Biochemical (Freehold, NJ); 8-(4-chlorophenylthio) guanosine 3 ,5 -cyclic monophosphate (8-pCPT-cGMP) and 5,6-dichloro-1- -D-ribofuranosyl benzimidazole 3 ,5-cyclic monophosphothioate, Sp-isomer (cBIMPS) were from Alexis Biochemicals (San Diego, CA); IP3 was from Calbiochem (San Diego, CA); Western blotting and chromatography material and protein assay kit were from Bio-Rad Laboratories (Hercules, CA); antibody to IP3R types I, II, and III were from Santa Cruz (Santa Cruz, CA).

Techniques: Phospho-proteomics, Inhibition

Journal: American journal of physiology. Gastrointestinal and liver physiology

Article Title: Selective phosphorylation of the IP3R-I in vivo by cGMP-dependent protein kinase in smooth muscle.

doi: 10.1152/ajpgi.00401.2002

Figure Lengend Snippet: Fig. 10. PKA-dependent IP3R-I phosphorylation by isoproterenol (1 M) and cBIMPS in permeabilized smooth muscle cells. Dispersed smooth muscle cells were labeled with 32P and permeabilized with saponin for 5 min. The cells were then treated with isoproterenol (1 M) or cBIMPS (10 M) in the presence or absence of myristoylated PKI (1 M) or KT5823 (1 M). [32P]IP3R-I was immunoprecipitated, and radioactivity in the bands was expressed as cpm. Immunoblots of the IP3R-I bands are shown for loading control. Values are means SE of 4 experiments. Significant increase in phosphoryla- tion (P 0.01) by both isoproterenol and cBIMPS was selectively suppressed by myristoylated PKI.

Article Snippet: [ -32P]ATP and [32P]orthophosphate were obtained from Amersham Pharmacia Biotech (Piscataway, NJ); collagenase and soybean trypsin inhibitor were from Worthington Biochemical (Freehold, NJ); 8-(4-chlorophenylthio) guanosine 3 ,5 -cyclic monophosphate (8-pCPT-cGMP) and 5,6-dichloro-1- -D-ribofuranosyl benzimidazole 3 ,5-cyclic monophosphothioate, Sp-isomer (cBIMPS) were from Alexis Biochemicals (San Diego, CA); IP3 was from Calbiochem (San Diego, CA); Western blotting and chromatography material and protein assay kit were from Bio-Rad Laboratories (Hercules, CA); antibody to IP3R types I, II, and III were from Santa Cruz (Santa Cruz, CA).

Techniques: Phospho-proteomics, Labeling, Immunoprecipitation, Radioactivity, Western Blot, Control

Journal: American journal of physiology. Gastrointestinal and liver physiology

Article Title: Selective phosphorylation of the IP3R-I in vivo by cGMP-dependent protein kinase in smooth muscle.

doi: 10.1152/ajpgi.00401.2002

Figure Lengend Snippet: Fig. 12. Selective inhibition of IP3-induced Ca2 release from smooth muscle microsomes by IP3R-I antibody. Ca2 release from smooth muscle microsomes by IP3 (1 M) was determined as de- scribed in the legend to Fig. 11. In some experiments, the micro- somes were first incubated with selective antibodies to IP3R-I, -II, or -III for 15 min. Values are means SE of 4 experiments. **P 0.01 significant inhibition of IP3-induced Ca2 release by IP3R-I antibody.

Article Snippet: [ -32P]ATP and [32P]orthophosphate were obtained from Amersham Pharmacia Biotech (Piscataway, NJ); collagenase and soybean trypsin inhibitor were from Worthington Biochemical (Freehold, NJ); 8-(4-chlorophenylthio) guanosine 3 ,5 -cyclic monophosphate (8-pCPT-cGMP) and 5,6-dichloro-1- -D-ribofuranosyl benzimidazole 3 ,5-cyclic monophosphothioate, Sp-isomer (cBIMPS) were from Alexis Biochemicals (San Diego, CA); IP3 was from Calbiochem (San Diego, CA); Western blotting and chromatography material and protein assay kit were from Bio-Rad Laboratories (Hercules, CA); antibody to IP3R types I, II, and III were from Santa Cruz (Santa Cruz, CA).

Techniques: Inhibition, Incubation